pe2 crimson c1 (TaKaRa)
TaKaRa is a verified supplier 
TaKaRa manufactures this product 
93
Structured Review
TaKaRa
pe2 crimson c1
Pe2 Crimson C1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pe2+crimson+c1/pE2-Crimson-C1+Vector/pm40543506-323-6-7
Average 93 stars, based on 3 article reviews
Pe2 Crimson C1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pe2+crimson+c1/pE2-Crimson-C1+Vector/pm40543506-323-6-7
Average 93 stars, based on 3 article reviews
pe2 crimson c1 - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Clone Assay:Article Title: Transferrin receptor controls both autophagosome formation and closure via phosphatidylinositol 3-phosphate synthesis. Article Snippet: MARCH8 myc WT and ΔC76 mutant were a gift from Hideaki Fujita (National Institute of Infectious Diseases 1-23-1 Toyama, Shinjuku, Tokyo 162-8640 JAPAN), pEGFP-MARCH8 WT was a gift from Paul Lehner (Cambridge Institute of Therapeutic Immunology & Infectious Diseases (CITIID), Cambridge, UK) and VPS36 (Myc-DDK-tagged- RC206006), TSG101 (Myc-DDK-tagged- RC200275), CHMP2B (Myc-DDK-tagged- RC201532), VPS37A (Myc-DDK-tagged- RC209716) are from Origene, HA-MAP1LC3A(Addgene # 137756). siRNA oligos control oligo 1: UGGUUUACAUGUCGACUAA control oligo 2: UGGUUUACAUGUUGUGUGA control oligo 3: UGGUUUACAUGUUUUCUGA control oligo 4: UGGUUUACAUGUUUUCCUA TfR oligo 9: GAAUGGAUCUAUAGUGAUUUU TfR oligo 11: GUAAACUGGUCCAAUGCUAAUU MARCH8 oligo 6: GAAUGGCCCUUUUGGACUA MARCH8 oligo 7: GAGCAGAAAUCAUUCACGU MARCH8 oligo 8: GGAAGAGACUCAAGGCCUA MARCH8 oligo 9: UAAAGUGUAUGUGCAAUUG VPS37A oligo 1: GCAGGACAGGCUUAGAGAAGAUU VPS37A oligo 2: GCUUCUAUACCGUGUCACAAAUU VPS36 oligo 7: AAACCGAGCUCGAGGAAUG VPS36 oligo 8: CGACUGAUUUGGAGAGAUC VPS36 oligo 9: CAAAGAACAUGGCCAGAUU VPS36 oligo 10: GGGAAUAGCUAACCCAGUU HRS oligo 5: GAGGUAAACGUCCGUAACA HRS oligo 6: GCACGUCUUUCCCAGAAUUC HRS oligo 7: AAAGAACUGUGGCCAGACA HRS oligo 8: GAACCCACACGUCGCCUUG .. VPS15 was cloned in pEGFP-C1 or pE2-Crimson-C1( Article Title: Protein aggregation can inhibit clathrin-mediated endocytosis by chaperone competition Article Snippet: Regions encoding EGFP-Atx1 Q2 or Q82 were subcloned into pcDNA5-FRT-TO vector (Life Technologies) between the AflII and NotI sites. .. The ORF of human HSC70 was PCR-amplified with the forward primer, GCGCTCGAGCTATGTCCAAGGGACCTGCAG, and the reverse primer, GCGGGATCCTTAATCAACCTCTTCAATGGTGGG, and the PCR fragment was cloned into Polymerase Chain Reaction:Article Title: Protein aggregation can inhibit clathrin-mediated endocytosis by chaperone competition Article Snippet: Regions encoding EGFP-Atx1 Q2 or Q82 were subcloned into pcDNA5-FRT-TO vector (Life Technologies) between the AflII and NotI sites. .. The ORF of human HSC70 was PCR-amplified with the forward primer, GCGCTCGAGCTATGTCCAAGGGACCTGCAG, and the reverse primer, GCGGGATCCTTAATCAACCTCTTCAATGGTGGG, and the PCR fragment was cloned into |